Antimicrob Agents Chemother 2005, 49:4798–4800.PubMedCrossRef 5. Littauer P, Caugant DA, Sangvik M, et al.: Macrolide-resistant Streptococcus pyogenes in Norway: population structure and resistance determinants. Antimicrob Agents Chemother 2006, 50:1896–1899.PubMedCrossRef 6. Bingen E, Bidet P, Mihaila-Amrouche L, et al.: Emergence of macrolide-resistant Streptococcus pyogenes strains in French children. Antimicrob Agents Chemother 2004, 48:3559–3562.PubMedCrossRef 7. Grivea IN, Al Lahham A, Katopodis GD, et al.: Resistance to erythromycin and telithromycin in Streptococcus pyogenes isolates obtained between 1999 and 2002 from Greek

children with tonsillopharyngitis: phenotypic and genotypic analysis. Antimicrob Agents Chemother 2006, 50:256–261.PubMedCrossRef 8. Montagnani F, Stolzuoli L, Croci L, et al.: Erythromycin resistance in Streptococcus pyogenes and macrolide consumption in a central Italian region. Infection 2009,

EPZ015938 chemical structure 37:353–357.PubMedCrossRef 9. Perez-Trallero Selleckchem CBL0137 E, Montes M, Orden B, et al.: Phenotypic and genotypic characterization of Streptococcus pyogenes isolates displaying the MLSB phenotype of macrolide resistance in Spain, 1999 to 2005. Antimicrob Agents Chemother 2007, 51:1228–1233.PubMedCrossRef 10. Silva-Costa C, Ramirez M, Melo-Cristino J: Rapid inversion of the prevalences of macrolide resistance phenotypes paralleled by a diversification of T and emm types among Streptococcus pyogenes in Portugal. Antimicrob Agents Chemother 2005, 49:2109–2111.PubMedCrossRef 11. Jasir A, Tanna A, Noorani A, et al.: High rate of tetracycline resistance in Streptococcus pyogenes in Iran: an epidemiological study. J Clin Microbiol 2000, 38:2103–2107.PubMed 12. Nir-Paz R, Block C, Shasha D, et al.: Macrolide, lincosamide and tetracycline susceptibility and emm characterisation of invasive

Streptococcus pyogenes isolates in Israel. Int J Antimicrob Agents 2006, 28:313–319.PubMedCrossRef 13. Reinert RR, Franken C, van Der LM, et al.: TH-302 supplier Molecular characterisation of macrolide resistance mechanisms of Streptococcus pneumoniae and Streptococcus pyogenes isolated in Germany, 2002–2003. Int J Antimicrob Agents 2004, 24:43–47.PubMedCrossRef 14. Green MD, Beall B, Marcon MJ, et al.: Multicentre surveillance of the prevalence and molecular epidemiology of macrolide resistance only among pharyngeal isolates of group a streptococci in the USA. J Antimicrob Chemother 2006, 57:1240–1243.PubMedCrossRef 15. Michos AG, Bakoula CG, Braoudaki M, et al.: Macrolide resistance in Streptococcus pyogenes: prevalence, resistance determinants, and emm types. Diagn Microbiol Infect Dis 2009, 64:295–299.PubMedCrossRef 16. Alos JI, Aracil B, Oteo J, et al.: High prevalence of erythromycin-resistant, clindamycin/miocamycin-susceptible (M phenotype) streptococcus pyogenes: results of a Spanish multicentre study in 1998. Spanish group for the study of infection in the primary health care setting.

Given SC79 order that S. fredii NGR234 and M. loti each contain homologs to all of these genes, except for fucA which is not necessary for the catabolism of any of the sugars [15], it follows that these two loci may also be capable of catabolising all three polyols. It has

also been established that the B. abortus and R. leguminosarum type loci are used for erythritol catabolism, and given the annotation and degree of relatedness (E value = 0) of proteins belonging to all species in the clade, it is not expected that these loci would be capable of breaking down additional polyols [20, 21]. This is supported by the fact that the introduction of the R. leguminosarum cosmid containing the erythritol locus into S. meliloti strains unable to utilize erythritol, adonitol, and L-arabitol were unable to be complemented for growth on adonitol and L-arabitol [15]. It is however necessary to remember that some of identified loci are only correlated with polyol utilization based on our analysis and that basic biological function, such as the ability to utilize these polyols has not been previously described. With the advent of newer

generations of sequencing technologies a greater number of bacterial genomes will be sequenced. It is likely that more examples of rearrangements of catabolic loci through bacterial lineages will be observed. Since the ability to catabolize erythritol is found in relatively few bacterial Fludarabine mouse MK-4827 molecular weight species, operons that encode erythritol and other associated polyols may be ideal models to observe operon evolution. Conclusions In this work we show that there are at least three distinct erythritol/polyol loci arrangements. Two distinct

ABC transporters can be found within these within these loci and phylogenetic analysis check details suggests these should be considered analogs. Finally we provide evidence that suggest that these loci have been horizontally transferred from the alpha-proteobacteria into both the beta and gamma-proteobacteria. Acknowledgments This work was funded by NSERC Discovery Grants to IJO and GH. BAG was funded by an NSERC CGS-D. The authors would like to thank the anonymous reviewer’s suggestions that greatly improved the manuscript. Electronic supplementary material Additional file 1: Figure S1: EryA phylogenetic tree was constructed using ML and Bayesian analysis. Support for each clade is expressed as a percentage (Bayesian / ML, ie. posterior probability and bootstrap values respectively) adjacent to the nodes that supports the monophyly of various clades. The branch lengths are based on ML analysis and are proportional to the number of substitutions per site. This phylogenetic tree was used in the mirror tree in Figure 2 without branch lengths due to space restrictions. (EPS 1 MB) References 1.

Morphotype switching was presented as the proportion (%) of alternative types in relation to the total colonies present. Discussion Our previous paper reported PS-341 ic50 a process of B. pseudomallei colony morphology switching that occurred during human melioidosis, and in an animal model, mouse FG-4592 solubility dmso macrophage cell line J774A.1, human lung epithelial cell line A549, and under starvation conditions in vitro. In this study, we investigated whether the variable phenotype associated with different morphotypes resulted in a survival

fitness or disadvantage during interactions with a human macrophage cell line U937 and after exposure to factors that simulate the macrophage milieu. Although our previous report described 7 different morphotypes from clinical isolates, the five isolates used here from 3 different clinical and 2 environmental samples were only observed to switch under nutritional limitation from parental type I to types II and III, allowing comparison of 3 isogenic morphotypes with known variable phenotype. The initial interaction between the human macrophage cell

line U937 and 3 isogenic morphotypes of B. pseudomallei was not different between the three types. Despite a comparable rate of extracellular growth between isogenic morphotypes, heterogeneity in subsequent intracellular survival/growth after this time point was observed. Type III of each isolate was inconsistently capable of multiplication after uptake by human macrophages, and was associated with a change in morphotype. This suggests that type III has a fitness disadvantage under these circumstances. Elafibranor mouse A possible explanation for this is that type III does not appear to

produce biofilm [11]. A biofilm mutant demonstrated a mark reduction in intracellular survival in primary human macrophages than the wild type, suggesting that biofilm production is associated with the ability to survive in human macrophages [8]. Our previous study examined the survival and replication of B. pseudomallei strain 153 in the human respiratory epithelial cell line Atorvastatin A549 and the mouse macrophage cell line J744A.1. Our finding here that type III of strain 153 had increased survival in the human macrophage cell line U937 is consistent with our previous findings for the mouse macrophage cell line J774A.1 infected with the same strain [11]. However, the use of a wider number of strains in this study demonstrated that there was a lack of reproducibility between strains. We suggest that this is likely relate to variability in genomic content between the strains tested. Future testing strategies require the evaluation of a large numbers of strains that have undergone whole genome sequencing to facilitate statistically robust comparisons between genomic variation and phenotypic behaviour. Several components of the innate immune system are efficient in killing organisms within human macrophages [15].

coli SM10λpir[16], mated into S. oneidensis MR-1 [9], and Gmr/Tcr single crossover recombinants were isolated. Following growth in LB liquid without selection, cultures of these single crossovers were plated to LB plates containing Gm, 5% sucrose (w/v), and 0.1% NaCl (instead of omiting NaCl to increase the likelihood of isolating an hfq mutant in the event that loss of hfq resulted in cells sensitive to hypoosmotic conditions). Gmr Sucr Tcs hfq∆ mutant candidates were screened via PCR and DNA sequencing of the disrupted region. The sequence of the primers used for diagnostic PCR in Figure

1 are as follows: A (hfq 5’ diagnostic) – ATAATGTGGTGCAATTTGCC; B (lacZ 5’ out) – CGTTGTAAAACGACGGGATCG; C (aacC1 3’out) – GATGCACTTTGATATCGACCC; D (hfq 3’ diagnostic) – GAGTCCAACCACGCACTAGG. Figure 1 Construction and verification of a null allele of the Shewanella oneidensis MR-1 hfq gene. (A) Knockout strategy for the MR-1 hfq gene. HM781-36B Most of the hfq gene coding sequence (all but the first 9 codons and last 6 codons) was replaced with a cassette containing a promoterless lacZ gene and a gentamicin resistance marker. (B) Agarose gel of analytical PCR reactions using wild

type MR-1 (lanes HMPL-504 clinical trial 2–4) or hfq∆ mutant (lanes 5–7) templates and primers A, B, C, and D (see Materials and Methods for primer sequences) indicated with arrows on the diagram in panel (A) The size standard (M) in lane 1 is 1kb plus DNA ladder (Invitrogen). (C) Western blot of SDS-PAGE-fractionated total protein from various Shewanella strains probed with a polyclonal antibody raised against E. coli Hfq protein. Lanes 1 and 2: MR-1 containing pBBR1-MCS-2 (vector) or hfq rescue construct (phfq), respectively. Lanes 3 and 4: hfq∆ containing vector or phfq, respectively. The antibody detects both putative Hfq monomers (~10kDa)

as well as putative Hfq homohexamers (~60kDa). To generate an hfq rescue construct, we PCR amplified a 1.3kb genomic fragment containing the S. oneidensis MR-1 hfq coding sequence and ~1kb upstream of the hfq open reading frame. Based on hfq promoter analysis in E. coli, this fragment likely contains the native promoters for Ribociclib chemical structure S. oneidensis hfq[17]. A PCR product was generated using the 5’ primer GGCAAGCTTCAGGAAAAACGGCTTTAGCTCTCG and the 3’ primer GGCGGTACCACTAAACCTTATTCGCCACTTGGC. Following restriction with HindIII and KpnI, this PCR product was ligated to HindIII/KpnI restricted pBBR-1MCS2 [18]. The resulting plasmid, pBBR1-hfq, was transformed into E. coli S17-1λpir[19] and mated into S. oneidensis strains. In our hands, the pBBR1-MCS2 based vectors were stably maintained in S. oneidensis strains after 30 hours in LB Km cultures and after 120 hours in modified M1 Km cultures (data not shown). Western blot analyses 3ml MM-102 aliquots of S. oneidensis cultures were pelleted in a microcentrifuge for 2’ at 20300 x g.

Although the known fossil GSK1120212 record of cellularly preserved microbes extends deep into the Precambrian—throughout all of the Proterozoic and much of the Archean—in units older than ~2,000 Ma

it becomes increasingly sparse and patchy, and the history of the various microbial lineages becomes increasingly difficult to click here decipher. The great oxidation event Despite the problems posed by the petering-out of the rock and fossil records over geological time, the record that has survived is sufficient to establish the presence of molecular oxygen and, by implication, of oxygen-producing photoautotrophs, at least as early as ~2,450 Ma ago. As summarized by Holland (2002) and Canfield (2005), beginning about 2,200 Ma ago and continuing to the present, sandstones known as red beds have been deposited on land surfaces by meandering rivers and windblown dust. The beds are colored red by the presence of the mineral hematite (Fe2O3), iron oxide that typically forms

a thin veneer on individual quartz sand gains and the presence of which indicates that the atmosphere at the time was oxidizing. In contrast, in numerous terrains older than about 2,400 Ma, conglomeratic beta-catenin inhibitor rocks filipin occur that contain detrital grains of pyrite and uraninite deposited in shallow-water deltaic settings, minerals that in the presence of molecular oxygen

are rapidly converted to their oxidized forms—for pyrite (FeS2), to the mineral hematite (Fe2O3); and for uraninite (UO2), to its soluble more oxidized form, UO4. If there had been appreciable oxygen in the overlying atmosphere when these sediments were laid down, hematite, rather than pyrite, would occur in such conglomerates and uraninite would have oxidized and been dissolved. The temporal distributions of red beds and of pyritic uraniferous conglomerates thus indicate that there was an increase in the amount of oxygen in Earth’s atmosphere some 2,200–2,400 Ma ago, a date that has recently been more firmly set by studies of sulfur isotopic ratios preserved in the rock record that evidence a major rise in atmospheric O2-content at ~2,450 Ma ago (Farquhar et al. 2000, 2007). Since photosynthesis produces well over 99% of the oxygen in the atmosphere, and since no other large-scale source of free oxygen is known, this increase of atmospheric O2 can be firmly attributed to the activities of oxygenic photosynthesizers.

Although the subjects of the present study were volunteers from one area of Japan, which was acknowledged as a limitation of the study, they may not be significantly different from the general population. Second, we agree with Dr. Kawada on the limitation of HOMA-IR. As we wrote in the article, the associations between undercarboxylated osteocalcin (ucOC) and glucose metabolism indices were considerably attenuated when 176 participants on drug therapy for diabetes mellitus were excluded from the analysis and remained significant between ucOC and FPG or HbA1c and, therefore, not significant between ucOC and HOMA-IR. In addition, when

we excluded 106 men whose FPG levels exceeded 140 mg/dl from the analysis, according to the opinion of Dr. Kawada, no significant association was observed between ucOC and

HOMA-IR. Therefore, we admit that the result including selleck products participants with hyperglycemia was interpreted with caution. Because of limitations of HOMA-IR, we did not use it as the primary outcome of our study. The main result of our study was that ucOC was associated with glucose metabolism while carboxylated osteocalcin was not, and this did not alter even if the result using HOMA-IR QNZ in vivo was not significant. Conflicts of interest None. References 1. Iki M, Tamaki J, Fujita Y, Kouda K, Yura A, Kadowaki E, Sato Y, Moon JS, Tomioka K, Okamoto N, Kurumatani N (2012) Serum undercarboxylated osteocalcin levels are inversely associated with glycemic status and insulin resistance in an elderly Japanese male population: Fujiwara-kyo Osteoporosis Risk in Men (FORMEN) Study. Osteoporos Int 23:761–770. doi:10.​1007/​s00198-011-1600-7

PubMedCrossRef 2. Health Service Bureau, Ministry of Health, Labour and Welfare (2011) The National Health and Nutrition Survey 2010. The Japanese Ministry of Health, Labour and Welfare, Tokyo”
“Erratum to: Osteoporos Int DOI 10.1007/s00198-013-2332-7 The legends for Figs. 2 and 3 appeared in the correct places but were accompanied by the wrong illustrations: Fig. 2 legend by Fig. 3 illustrations, and Fig. 3 legend by Fig. 2 illustrations. The two figures are reproduced here in their correct form. Fig. 2 Hip fracture rate. 95 % confidence intervals around point estimate. Note the early separation of the two cohorts with a lower fracture rate for PF-3084014 nmr risedronate than for alendronate during the early phase (6–12 months) of treatment Fig. 3 Nonvertebral fracture rate. Inositol monophosphatase 1 95 % confidence intervals around point estimate. Note the early separation of the two cohorts with a lower fracture rate for risedronate than for alendronate during the early phase (6–12 months) of treatment”
“Introduction Osteoporosis in men is increasingly recognized as a major public health problem [1]. Although osteoporosis is less common in men than in women, it has been estimated that around 30 % of hip fractures occur in males and one out of five men aged 60 years will experience an osteoporotic fracture during their remaining lifetime [2, 3].

The FEO is expressed when animals have access to food on restricted schedules (2 to 4 h of mealtime per day over a period of 2 or 3 weeks). The restricted feeding schedule (RFS) increases locomotive activity and arousal during the hours immediately before food access, generating a condition known as food anticipatory activity (FAA) [9]. Ilomastat clinical trial FAA is characterized by a variety of physiological and behavioral changes in the organism such as: increases in wheel running activity, water consumption, and body temperature, as well as a peak of serum corticosterone [9–11]. So far, the anatomical location of the FEO is unknown,

but the physiology of this oscillator is thought to involve the bidirectional communication between specific, energy-sensitive brain areas and nutrient-handling, peripheral organs, especially the liver [8, 9, 11]. The liver is primarily composed of parenchymal cells or hepatocytes (80% by volume) and four types of non-parenchymal cells: endothelial, Kupffer, Ito, and pit cells. Hepatic tissue is highly specialized and functions

as a major effector organ, acting as: 1) principal center of Belnacasan cost nutrient metabolism, 2) major component of the organism defensive response, 3) control station of the endocrine system, and 4) blood reservoir [12]. The hepatic gland performs a strategic role in the digestive process by receiving the nutrients from the diet and AZD6738 orchestrating their transformation into useful biomolecules to be delivered to other organs and tissues. Hence, the liver is fundamental in the

metabolism of carbohydrates, lipids, and all other biomolecules. Hypothalamic and midbrain nuclei are connected via vagal and splanchnic nerves to the liver, allowing the hepatic organ to participate in the control of food intake by sensing and regulating the energy status of the body [13]. FEO expression promotes dramatic changes in the physiology and metabolic performance of the liver [11, 14, 15]: During the FAA (before food access), there is a prevalence of this website oxidized cytoplasmic and mitochondrial redox states, an increase in adenine nucleotides levels, an enhanced mitochondrial capacity to generate ATP, and a hypothyroidal-like condition that is not systemic but exclusively hepatic. In contrast, after feeding the hepatic redox state becomes reduced in both cytoplasmic and mitochondrial compartments, the levels of ATP decline, and the level of T3 within the liver increases. However, not all the adaptations in the liver during RFS occur before and after food intake. A constant reduction in pro-oxidant reactions (conjugated dienes and lipid peroxides) in most hepatocyte subcellular fractions and a persistent increase in the mitochondrial membrane potential (ΔΨ) are observed along FEO expression [14, 16]. In addition, the liver is the organ that displays the fastest shift in the phase of clock-control genes and molecular outputs in response to food access being restricted to daytime in nocturnal rodents [17].

[18]: MφP9

(CD14), SJ25C1 (CD19), MAR4 (CD29), 8G12 (CD34), 515 (CD44), 2D1 (CD45), IA10 (CD55), p282 (CD59), AD2 (CD73), 5E10 (CD90), SN6 (CD105), 104D2 (CD117), and L243 (HLA-DR). All of these monoclonal antibodies were obtained from BD Biosciences (San Jose, CA), except for SN6 from Invitrogen (Carlsbad, CA). Cells were resuspended in a total number of 2 × 105 in 50 μl of phosphate-buffered saline (PBS) supplemented with 4% FBS, then incubated with 20 μl of monoclonal antibodies, except for 5E10 (2 μl) and SN6 (5 μl), for 45 min at 4°C, and the conjugated cells fixed with 1 ml of 4% check details paraformaldehyde solution (Wako, Osaka, Japan). Flow cytometric analysis was performed with Cell Quest software and the FACSCalibur device (BD Biosciences) to examine 20,000 events. In vitro differentiation toward GW3965 cost adipocytes, chondrocytes, and osteocytes To induce adipogenesis and osteogenesis, 1 × 103 cells were cultured in 500 μl of medium in a four-well chamber slide. Three days after propagation, the culture medium was replaced with 500 μl of StemPro adipogenesis or osteogenesis differentiation medium (Gibco) containing 5 μg/ml of gentamicin. Chondrogenesis was induced with a micromass culture system [19, 20], in which 5 × 102 of the cells were resuspended in 10 μl of culture medium and applied to

the center of a culture well. A 96-well Barasertib culture plate was used in our study. Two hours after propagation, 100 μl of StemPro chondrogenesis differentiation medium containing 5 μg/ml of gentamicin was added. The differentiation medium was replaced twice a week. Mixed lymphocyte culture assay PBMCs were separated from the heparinized peripheral blood of a healthy donor by means of Ficoll-Paque density gradient centrifugation (Amersham Biosciences, Uppsala, Sweden). CD3+ T-cells were purified from PBMCs by magnetic-activated cell sorting (MACS) positive selection (Miltenyi Biotec, Auburn, CA) and

1 × 106 of these cells were cultured for 48 h in a 96-well culture plate in the presence of 12.5 μg/ml of phytohemagglutinin (Wako) with or without irradiated (25 Gy) HPB-AML-I and UCBTERT-21 (0, 1 × 103, 1 × 104, and 1 × 105 cells/well) cells. From each culture well, 100 μl of cell suspension was pulsed with 10 μl of Cell Counting Kit-8 solution (Dojindo, Morin Hydrate Tokyo, Japan) at 37°C for 4 h. The optical density at 450 nm was measured to determine cell viability in each of the culture wells. Results HPB-AML-I shows plastic adherence, negative myeloperoxidase expression, and complex chromosomal abnormalities Inverted microscopic examination (Figure 1A) and May Grünwald-Giemsa staining (Figure 1B) of HPB-AML-I cells revealed that this cell line is composed of round-polygonal and spindle-like cells. Unlike the round-polygonal cells, HPB-AML-I cells with the spindle-like morphology attached to plastic surfaces.

(Sm) Streptomycin; (Km) Kanamycin; (Gm) Gentamycin; (Amp) Ampicillin; (PnG) Penicillin G;

(Tet) Tetracycline; (Cm) Chloramphenicol; (Rif) Rifampicin. Overall, the assessed Selleckchem BIBF-1120 physiological characteristics strongly varied across the monophyletic clade of Streptomyces symbionts, with the GSK2245840 mouse strains isolated from Eurasian/African Philanthus species showing the lowest metabolic versatility, followed by the South American Trachypus, while Philanthinus and the North American Philanthus species harboured symbionts that were more flexible in terms of nitrogen assimilation and antibiotic resistance. Diversity of symbiont Rabusertib cell line strains

within individual beewolf antennae Since populations of symbiotic Streptomyces suffer significant bottlenecks during vertical transmission [26], genetic diversity within individual antennae could be expected to be low. However, recent phylogenetic analyses provided evidence for relatively frequent horizontal symbiont exchange among host species, raising the question whether individual antennae may in fact simultaneously harbour different bacterial lineages. Therefore, we set out to assess the diversity of symbionts growing within the same antenna. For this analysis we used the antennae of two P. multimaculatus and one P. psyche specimen for the isolation of individual symbiont micro-colonies. These biovars were selected because in liquid medium they formed small

(about 1 mm), compact, well-separated colonies. 24 individual colonies of each strain were harvested from the original enrichments and subjected to sequence analysis of the gyrB gene fragment, which provides higher phylogenetic resolution than the 16S rRNA gene. Cetuximab Perhaps due to different cell wall thickness, colony PCR and further sequence analysis succeeded with different efficiencies: 21 and 18 high quality sequences were obtained from the two ‘multimaculatus’ specimens (samples 570 and 571, respectively), but only six sequences from the ‘psyche’ biovar. Sequence analysis of gyrB revealed no heterogeneity among the analyzed isolates within each host individual, suggesting low levels of (micro) diversity or even clonality of the symbionts in individual beewolf antennae. Opportunistic bacteria Beewolf antennae are constantly exposed to the environment, and non-specific bacteria are potentially able to colonize the gland reservoirs, especially in cases where the host fails to acquire its specific symbionts [28]. These bacteria, not belonging to the clade ‘S.

The distribution of these LSPs was thus

investigated Selleckchem PF-6463922 across our representative panel of Map S-type selleck chemicals llc strains from various origins. As shown in Figure 1, analysis by PCR supports the association of the LSPA20 region with C-type strains whereas the LSPA4 region is present in all S-type strains. Presence of the LSPA4 region was not related to PFGE subtype I versus III, of the country of origin and pigmentation status (Table 1). Figure 1 Detection of types and subtypes of strains based on of the absence or presence of large sequences LSPA4 (A) and LSPA20 (B) investigated by PCR. SNP analysis Since SNPs found in gyrA and B genes have been reported to be subtype (I, II, III)-specific, the panel of Map S-type strains was subjected to SNP analysis and compared to C type K-10 strain. As shown in Table 3, consensus sequences obtained matched those previously published and distinguished types I, II and III of Map. Table 3 SNPs found in gyrA and gyrB genes for M. avium subsp. paratuberculosis strain K-10 and M. avium subsp. paratuberculosis types I and III Strains Type IS900 RFLP profiles gyrA gyrB position 1822 1986 1353 1626 K10* II R01 CCCGAGGAGCGGATCGCT- ACTCGTGGGCGCGGTGTTGT selleck screening library CCGGTCGACCGATCCGCGC- CCAGCACATCTCGACGCTGT

6756 I S1 …..A….- ………. ……C…- ………. 6759 I S1 …..A….- ………. ……C…- ………. P133/79 I S2 …..A….- ………. ……C…- ………. 21P I S2 …..A….- ………. ……C…- Selleckchem Rucaparib ………. 235 G I S2 …..A….- ………. ……C…- ………. M189 I S2 …..A….- ………. ……C…- ………. M15/04 I S2 …..A….- ………. ……C…- ………. M254/04 I S2 …..A….- ………. ……C…- ………. M71/03 I S2 …..A….- ………. ……C…- ………. M72/03 I S2 …..A….- ………. ……C…- ………. 22 G III A …..A….- …..T….. ……C…- …..T….. OVICAP16 III A …..A….- …..T….. ……C…- …..T…..

OVICAP49 III A …..A….- …..T….. ……C…- …..T….. 21I III B …..A….- …..T….. ……C…- …..T….. PCR311 III B …..A….- …..T….. ……C…- …..T….. 19I III C …..A….- …..T….. ……C…- …..T….. 85/14 III C …..A….- …..T….. ……C…- …..T….. OVICAP34 III D …..A….- …..T….. ……C…- …..T….. 18I III E …..A….- …..T….. ……C…- …..T….. FO21 III F …..A….- …..T….. ……C…- …..T….. LN20 III I1 …..A….- …..T….. ……C…- …..T….. 269OV III I10 …..A….- …..T….. ……C…- …..T….. M284/08 III I10 …..A….- …..T….. ……C…- …..T….. P465 III I2 …..A….- …..T….. ……C…- …..T…..