The botanical and geographical origin of honey may be evaluated through melissopalynology, which is used to assess the pollen types present in the honey and to suggest its floral source. In the Brazilian Amazonia, few melissopalynological studies have been PF-02341066 clinical trial conducted since the 1980s. Pollen foraging has been studied, especially in the genus Melipona; however, the pollen found in Melipona honey has been poorly studied in this region ( Rech & Absy, 2011). Taking into account all these aspects, the present study was undertaken with the purpose of determining the

botanical origin and phenolic compound profile of honeys produced by the species M. (Michmelia) s. merrillae in seven counties of the Amazonas state in the Northern region of Brazil. In addition, we evaluated the honeys for antioxidant and antimicrobial activities. The reagents Folin–Ciocalteu, potassium persulfate, Trolox (6-hydroxy-2,5,7,8-tetramethylchroman-2-carboxylic acid 97%), ascorbic acid, gallic acid, ABTS [2,2′-azinobis-(3-ethylbenzothiazoline-6-sulfonic acid)] and the phenolic standards were supplied by Sigma–Aldrich (St. Louis, MO). The solvents ethyl acetate, methanol, ethanol and DSMO were supplied by Cinética e Tédia

(Brazil), and the Mueller–Hinton agar and the Sabouraud Dextrose Agar were purchased from Difco Laboratories (Detroit, GSK-3 activation MI). The samples of honey from the species M. s. merrillae were collected from beehive meliponaries in seven counties from Amazonas state, Brazil. There were four counties chosen from the Central region of Amazonas state [Manaus (CAD1), Rio Preto da Eva (CAD2), Coari (CAD3) and Maués (CAD4)], and there were three counties chosen from the Southern region of Amazonas [Boca do Acre (SAD1), Pauini (SAD2) and Lábrea (SAD3)]. The collection was performed with 20-mL sterile disposable syringes, and the honey was transferred to 600-mL polyethylene bottles,

which were stored at 8 °C until analysis. The methanol extracts and the ethyl acetate fractions of the honey samples were prepared following the methodology previously described by Andrade, Ferreres, and Amaral (1997). Initially, 50 g of honey, 250 mL of water acidified with hydrochloric acid (pH 2) and 100 g of Amberlite XAD-2 resin were mixed. After homogenisation aminophylline using a magnetic stirrer for 30 min, the mix was transferred to a glass column (42 × 3.2 cm) and was washed with 250 mL of acidified water (pH 2), followed by 300 mL of distilled water. The elution was performed with 300 mL methanol. To obtain the extract, the solvent was removed at 40 °C under reduced pressure in a rotary evaporator. Fractionation with ethyl acetate for the removal of sugars was performed utilising 1 g of the methanol extract, to which 5 mL of distilled water and 5 mL of ethyl acetate were added.

To date several techniques have been used for the authentication and classification of apple juices and similar beverages, these include chemical profiling (Souza et al., 2011) stable isotopes analysis (Magdas & Puscas, 2011), infra-red spectroscopy e.g. NIR, MIR, FT-IR (Kelly and Downey, 2005, León et al., 2005 and Sivakesava et al., 2001),

chromatographic techniques e.g. GC–MS (Fisk et al., 2012, Guo et al., 2012, Lignou et al., 2013 and Montero-Prado et al., 2013) and HPLC (Yamamoto et al., 2008) and direct injection spectrometric techniques such as PTR-MS (Biasioli et al., 2003 and Biasioli et al., 2011). Direct injection APCI-MS has been successfully applied in a number of areas, GSK1120212 most of these relate to the real time tracking of volatile compound release (Taylor, Linforth, Harvey, & Blake, 2000) to understand the dynamic partitioning from complex systems such

as food (Linforth, Baek, & Taylor, 1999) and beverages (Shojaei, Linforth, & Taylor, 2007) or as tool to evaluate different processing methodologies (Fisk et al., 2011, Fisk et al., 2012, Yang et al., 2012 and Yu et al., 2012) Notwithstanding its use as tool for real time aroma analysis, APCI-MS can also provide a rapid and informative mass spectral fingerprint of a foods volatile compliment; it can therefore be hypothesised that APCI-MS could be used for the monitoring of food authenticity. The aim of the present work was to evaluate APCI-MS as a novel tool for the classification (based on geographical Dabrafenib cell line and botanical origin) of a foods volatile compliment, using a real food (clarified apple juice) with broad commercial diversity as an exemplar. Five

cultivars (Braeburn, Golden Delicious, Granny Smith, Jazz (Scifresh), and Pink Lady) harvested in three different countries of Liothyronine Sodium the South hemisphere (New Zealand, South Africa, Chile) were purchased from four local supermarkets. For each cultivar, 12 apples were randomly selected and used for the preparation of apple juice samples. Apples were peeled, cored, sliced and placed in an antioxidant solution to retard enzymatic browning, as previously illustrated by Ting et al. (2012). Apple flesh was squeezed using a household juicer (Philips, UK) and the freshly extracted apple juice was immediately heat treated at 60 °C for 30 s using a water bath to retard any further enzyme activity. Excessive pulp and foam were removed from the juice by filtering through a 100-mesh cloth filter. Clarification of the apple juice was conducted by pectinase (Sigma–Aldrich, UK) treatment at 37 °C for 60 min and subsequent centrifugation of the juices at 5000 rpm (Beckman Ltd., J2-21M, UK) for 10 min. A total of 210 apple juices were prepared. For GC–MS headspace analyses six individual apple juices samples per cultivar referring to different market suppliers and geographical origin were selected.

This preliminary step increases the metal concentration at the electrode surface and enhances the sensitivity of the stripping step ( Mohadesi and Taher, 2007 and Yantasee et al., 2004). In this study, a novel carbon paste electrode (CPE), containing microspheres of chitosan crosslinked with 8-hydroxyquinoline-5-sulphonic acid and glutaraldehyde (CPE-CTS) for determination of Cu(II)

by square wave anodic stripping voltammetry, was constructed. Experimental conditions affecting the pre-concentration step, including the solution pH, potential and time of pre-concentration, were evaluated. Although the proposed sensor can be used to determine other heavy metals, GABA receptor function since microspheres of chitosan crosslinked with 8-hydroxyquinoline-5-sulphonic acid can act as an adsorbent for several metallic ions (Vitali et al., 2008), the performance of the proposed sensor was examined using optimised operating parameters for Cu(II) determination in instant coffee samples. Copper was chosen as the test element because it

has been found to be best suited to identifying the geographical growing origin of coffee, together http://www.selleckchem.com/products/ABT-888.html with manganese and cobalt (Oleszczuk et al., 2007). Therefore, the main goal of this work is to show that the proposed CPE-CTS sensor can be successfully used to determine Cu(II) in instant coffee samples. The determination of metals in coffee is commonly carried out in green coffee. To the best of our knowledge, the determination of Cu(II) in instant coffee is shown here for the first time. All reagents were of analytical grade and all the solutions were prepared with ultrapure water obtained from a Millipore Milli-Q system (18.2 MΩ cm). Chitosan (deacetylation Mannose-binding protein-associated serine protease degree of 80%), 8-hydroxyquinoline-5-sulphonic acid, glutaraldehyde and copper nitrate were acquired from Sigma. Graphite powder and Nujol were purchased from Fischer Scientific and Aldrich, respectively. Acetate buffer (0.1 mol L−1, pH 4.0, 5.0 and 6.0); tris(hydroxymethyl)aminomethane (0.1 mol L−1, pH 7.0 and 8.0) and ammonia (0.1 mol L−1, pH 9.0 and 10.0) solutions were tested as supporting electrolytes. Square wave

and cyclic voltammetry experiments were performed on an electrochemical detector, a Voltalab PGZ-100 potentiostat/galvanostat (Radiometer, Copenhagen, Denmark), equipped with a three-electrode system: a carbon paste electrode containing crosslinked chitosan (CPE-CTS) as the working electrode, a platinum wire as the auxiliary electrode, and an Ag/AgCl electrode as the reference electrode. The system was coupled to a microcomputer and controlled by VoltaMaster 4.0 software (Radiometer, Copenhagen, Denmark), for data acquisition and subsequent analysis. The weighing of reagents and mineralisation of coffee samples were carried out on a Shimadzu analytical balance, model AY-220, and in a Jung muffle, model BTC-9090, respectively.

A catalogue of generic and specific exposure scenarios (ESs) has been developed for engineered nanomaterials (ENM), taking into account the release scenarios over the entire life-cycle of these materials (Brouwer et al., 2010 and Clark et al., 2012). For occupational exposure scenarios, published measurement data and contextual information were collected. These were reviewed to describe and characterize occupational exposure and the available tools and models to predict occupational exposure

to the ENMs. For the development of generic exposure scenario descriptions, a library for the collection of exposure scenarios according to REACH Guidance was developed. From the 57 occupational exposure scenarios Protease Inhibitor Library in vitro (Brouwer et al., 2010), 14 are related to carbon-based nanomaterials, generating 35 contributing

exposure scenarios describing some facet of occupational exposure. Most of the ESs were from the production/synthesis of carbon-based nanomaterials or from handling materials (weighting, removing, sonication, etc.); two scenarios addressed tasks related to the machining of composites containing CNT. Based on the process of developing these ESs, several main conclusions could be drawn (Clark selleck et al., 2012): Most studies reported had an explorative character and were focused on concentration/emission analysis. Therefore, the reports from these studies did not include most of the information necessary to build ESs, e.g. amount used and frequency of activities. Basic characterization of the products used was often not available and operational conditions were often not described. Most concentration/emission-related measurement results were task-based. An important observation was the

lack of harmonization of either the measurement strategy including distinction between manufactured nanoaerosols and ‘background’ aerosols, or the ADAM7 analysis and reporting of measurement data. ENM-release during synthesis is best described by an emission factor (EF), which is defined as number, surface area and/or mass (volume) per unit of time released to the environment (Fissan and Horn, 2013). The ENM-release per unit of mass of produced material is best described by a release factor (RF), defined as number, surface area and/or mass (volume) per unit of mass of nanostructured material (Fissan and Horn, 2013). This depends on nanostructured material properties and the amount and kind of energy input during the different kinds of treatments of the material. The ENM emission and release factors can be considered to be important process and material properties, since without emission and release there is no exposure and therefore no risk.

At DC values greater

than 500 persistent smouldering is likely to occur. However, smouldering of the duff layer and pleurocarpous mosses seems to have been initiated at lower levels of the DMC (33) than those recorded by Lawson et al. (1997) for similar fuels (80–90 for white spruce duff, 76–81 for pleurocarpous mosses). Further research should determine such flammability thresholds for fire-prone vegetation types in the UK. The UK is currently poorly placed to either assess the overall impact of peatland fires on national carbon emissions or to forecast the conditions under which such fires occur. As Davies et al. (2008) previously pointed out, there is an urgent need to develop a co-ordinated approach to collecting data on the incidence and impact see more of peatland wildfires. Existing tools, such as the FWI system, VEGFR inhibitor should also be modified to forecast conditions when

peat fires can occur. To achieve this further research is needed on the relationship between peat fuel moisture and the moisture codes of the FWI system when fire events are more likely to occur. Wildfires that ignite peat deposits represent a significant potential feedback to climate change and improved tools and tactics to forecast, prevent and fight them are urgently needed. Study of the carbon release associated with smouldering combustion during the Rothiemurchus wildfire has added to a growing body of evidence (Table 5) showing

that even small events of this nature can release significant quantities of carbon. Our results also provide circumstantial evidence that afforestation of peatland soils, and associated site preparation, may contribute to an increased risk of peat fires. This requires further study and should be accounted for in the planning of future forestry operations particularly in the light of climate change forecasts that suggests conditions suitable for severe summer wildfires may become more frequent (Jenkins L-gulonolactone oxidase et al., 2010). Increases in the frequency and severity of peatland wildfires have been shown to be a potentially significant positive feedback on climate change in other regions (Field et al., 2007, Turetsky et al., 2011a and Turetsky et al., 2011b) and it would be sensible for peatland managers in the UK to also be concerned. Attempts have recently been made to estimate the relative contribution of different types of burn to global C emissions from wildland fire (van der Werf et al., 2010). This research was based on MODIS active fire and burned area maps but it is not clear if such remotely sensed data is able to catch the kind of smouldering wildfire that accounted for most of the ground fuels consumed in our study.

g., when the origins of existing farmland introductions are unknown; Dawson et al., 2008). Commercialising the wild harvest of NTFPs has been widely promoted as a conservation measure, based on the assumption that an increase in resource value is an incentive for collectors to manage forests and woodlands more sustainably (FAO, 2010). Experience shows, however, that the concept of commercialisation and conservation proceeding in tandem is often illusory (Belcher Paclitaxel molecular weight and Schreckenberg, 2007), as more beneficial livelihood outcomes are generally associated with more detrimental environmental outcomes (Kusters et al., 2006). The harvest

of fruit from the argan tree (Argania spinosa), endemic to Morocco, is a good illustration of the dilemmas involved. The oil extracted from the kernels of argan fruit is one of the most expensive

edible oils in the world and development agencies have widely promoted a ‘win–win’ scenario for rural livelihoods and argan forest health based on further commercialisation ( Lybbert et al., 2011). As Lybbert et al. showed, however, while the booming oil export market has benefited the local economy, it has also contributed to forest degradation. In circumstances where NTFPs are over-harvested from the wild, a widely-advocated method to alleviate AZD2281 order pressure on natural stands and support their more sustainable use has been the cultivation of additional product Liothyronine Sodium sources in farms and plantations (e.g., Lange, 1998 and Strandby-Andersen et al., 2008). Although intuitive, there is surprisingly little clear evidence that this approach works, and some authors have suggested that cultivation may have a detrimental impact on forest and woodland NTFP populations (reviewed in Dawson et al., 2013), as planting can, for example, result in forest populations being degraded to ‘stop-gap’ supply status while cultivated stands mature (Clapp, 2001). Cultivation may also stimulate market development

that unintentionally ‘captures’ forest as well as planted product sources (Cossalter and Pye-Smith, 2003). Gaining an understanding of the circumstances in which positive linkages can be achieved between cultivation and the conservation of forest and woodland NTFP populations is not straightforward, and the topic requires active research (Dawson et al., 2013). Measures that support productivity under cultivation, such as genetic selection and improved management, may better support wild stand conservation (through ‘out-competition’). However, as already noted, this may result in poorer management of natural populations, and such a move may disadvantage the livelihoods of the very poor in communities who do not have access to land for planting and so can only harvest resources from the wild (Page, 2003).

Purified genomic DNA from several human-associated microorganisms in the oral cavity was purchased from ATCC (Manassas, Forskolin VA). Buccal swab lysates were prepared to generate a reference database for concordance studies as described above. PCR amplification reactions were prepared by combining 6 μL of GlobalFiler Express

primer mix, 6 μL of master mix, and 3 μL of buccal cell lysate to give a total reaction volume of 15 μL according to the manufacturer’s protocol [12]. For positive control DNA 007 (supplied in the GlobalFiler Express Kit, ThermoFisher Scientific) reactions, 6 μL of primer mix, 6 μL of master mix, and 1 μL of sterile water was combined and then 2 μL of control DNA 007 (2 ng/μL) was added. Thermal cycling was performed on the GeneAmp® PCR system 9700 (ThermoFisher Scientific) with a 96-well gold-plated silver block. Thermal cycling parameters used the 9700 max mode: enzyme activation at 95 °C for 1 min, followed by 26 cycles of denaturation at 94 °C for 3 s and annealing/extension at 60 °C for 30 s. A final extension step was performed at 60 °C for 8 min, followed by a final hold at 4 °C if the PCR products were to remain in the thermal

cycler for an extended time. Cycle number was increased to 27 when re-amplifying samples with partial profiles. Following thermal cycling, samples were prepared for capillary electrophoresis (CE) according to the manufacturer’s protocol with GeneScan™600 LIZ® v2 and 500 LIZ® size standards [12]. Separation was performed on a 16-capillary 3130xL Genetic Analyzer (ThermoFisher Scientific) using a 36 cm capillary array, HIDFragmentAnalysis36_POP4 Luminespib run module with dye Protein kinase N1 set J6. If a sample yielded off-scale peaks it was rerun after decreasing injection parameters from 3 kV for 10 s to 2 kV for 5 s. The electrophoresis results were analyzed using GeneMapper ID-X v1.4 genotyping software (ThermoFisher Scientific) using a 20% global filter and the recommended analysis settings for GlobalFiler® Express v1.2 chemistry. Peak amplitude of 50 RFU (relative fluorescence units) was used as the peak detection threshold when analyzing data from all electropherograms. PCR

reaction mix for the RapidHIT System was prepared using the same ratios as suggested by the manufacturer [12]. The primer mix and master mix reagents were preloaded into two separate vials prior to insertion of vials onto the sample cartridges. 20 μL of primer mix plus 5 μL of sterile water was combined and added to one vial and 20 μL of master mix plus 5 μL of sterile water was combined and added to the second vial. The two vials were inserted onto the cartridge for each PCR reaction. Once the paramagnetic beads containing extracted, purified DNA were transferred to the PCR reaction chamber, the master mix and primer mix were dispensed simultaneously into the chamber. The total volume of the PCR amplification chamber was approximately 20 μL.

The following primers and probe were used: 244 1F (5′ CTCTTTGCCCAGAATGAGGAAT 3′), 244 1R (5′ CATAATCAAGAAGTACACATCAGGAAGAC 3′) and probe (5′ FAM-CCCTCAGTCTTCTCC 3′). Primers were synthesized by Invitrogen, and the probes by ABI. Reverse transcriptase reactions (10 μl) were performed using 6 μl extracted RNA, RevertAid reverse transcriptase and random hexamer (Fermentas) according to the manufacturer’s instructions. cDNA (1 μl) was

used in 20 μl of PCR reaction. A virion-sense 244 RNA standard was made by subcloning PCR products of full length 244 RNA in pGEMT-easy vector GSK-3 inhibitor review (Promega). RNA was transcribed using the T7 polymerase (MEGAscript, Ambion), the mix was digested with DNase I, and RNA purified by electro-elution. After ethanol precipitation, RNA was resuspended into RNase-free water and quantitated on a Nanodrop 1000 (Thermoscientific, Wilmington, DE). Standard curves

were generated by performing 10-fold serial dilutions of known RNA copy numbers with each dilution assayed in duplicate. The reaction was conducted at 50 °C for 2 min, 95 °C for 10 min, then 40 cycles of 94 °C for 15 s followed by 60 °C for 1 min. Nasal washes from each ferret were titrated for A/Cal infectivity in a focus-forming Palbociclib concentration assay using MDCK cells in 96-well plates in triplicate (Scott et al., 2011a). After infection cells were incubated at 33 °C for 24 h, fixed overnight these at 4 °C with 1:1 methanol:acetone, and blocked with 5% w/v milk powder in PBS. Virus-positive cells were detected using a mouse monoclonal antibody that recognises the NP protein of influenza A viruses (9G8 Abcam), and a goat anti-mouse IgG-alkaline phosphatase conjugate (Sigma), both in buffered saline containing 0.1% v/v Tween, and finally incubated with an alkaline phosphatase substrate (NBT/BCIP in TMN buffer; Sigma). At least 50 stained cells (foci) at an appropriate dilution were counted in each of three wells and averaged to give a titre in focus-forming units (FFU) per ferret. Assays carried out on different days were normalised to a standard A/Cal virus preparation.

Variation in the standard was less than 4-fold. Before assay sera were treated with receptor destroying enzyme (RDE II (SEIKEN), Cosmos Biological) overnight at 37 °C to remove non-specific inhibitors of haemagglutination and then incubated at 56 °C for 30 min to destroy the enzyme. Serial 2-fold dilutions of serum were incubated with 4 HAU of A/Cal for 1 h at ambient temperature before adding chicken red blood cells (VLA, Weybridge). The HI titre is expressed as the reciprocal of the dilution of serum that causes 50% inhibition of agglutination, and is interpolated between full agglutination and no agglutination. Analyses of the weights of the animals and the percentage weight changes relative to the weight on day 0 were carried out with a repeated measures ANOVA.

KRG and its extracts have been shown to possess multiple pharmacological activities that are useful for treating various human diseases, such as cardiovascular diseases, hypertension, wounds, cerebral ischemia, diabetes mellitus, liver regeneration, antiangiogenesis, and rheumatoid Selleckchem Enzalutamide arthritis [12], [13], [14], [15], [16], [17] and [18]. In recent days, the use of whole ginseng products such as steamed ginseng (KRG), ginseng powder, and ginseng extracts has seen a resurgence in use as alternative medicines in Europe as

well as in Asian countries. However, the protective activity of KRG against Dex-induced osteoporosis in vitro and in vivo has not yet been comprehensively explained. In this study, we determined the protective effects of KRG against Dex-induced apoptosis, as well as the molecular mechanism

regulated by KRG in MC3T3-E1 cells in vitro and the alteration of trabecular bone loss in a GC-induced osteoporosis mouse model in vivo. All the cell culture media and supplements were Gibco products (Life Technologies, Waltham, MA, USA). RNAisol and all polymerase chain reaction (PCR) reagents were obtained from Takara Bio Inc. (Shiga, Japan). Dex, ascorbic acid, β-glycerophosphate, and 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) were obtained http://www.selleckchem.com/products/Bafilomycin-A1.html from Sigma-Aldrich (St Louis, MO, USA). Antiphospho-p38 mitogen-activated protein kinase (Thr180/Tyr182), antiphospho-c-Jun N-terminal kinase (p-JNK; Thr183/Tyr185), antiphospho-AKT (p-AKT; ser 473), and anti-β actin antibodies were

purchased from Cell Signaling Technology (Danvers, MA, USA). KRG extracts were provided by the Korea Ginseng Corporation (Daejeon, Korea) from the roots of a 6-year-old red ginseng (Panax ginseng selleckchem Meyer) plant harvested in the Republic of Korea. KRG was prepared by steaming fresh ginseng at 90–100°C for 3 h and then drying at 50–80°C. KRG extract was prepared from red ginseng water extract, which was extracted at 85–90°C using three 8-h cycles of circulating hot water. Water content of the pooled extract was 36% of the total weight. KRG was analyzed by high-performance liquid chromatography. The major ginsenosides present in KRG extract were as follows: Rb1, 7.53 mg/g; Rb2, 2.86 mg/g; Rc, 2.86 mg/g; Rd, 0.89 mg/g; Re, 1.90 mg/g; Rf, 1.12 mg/g; Rg1, 1.78 mg/g; Rg2s, 1.12 mg/g; Rg3r, 0.72 mg/g; and Rg3s, 1.37 mg/g; minor ginsenosides were also present. Osteoblastic MC3T3-E1 cells (CRL-2593; ATCC, VA, USA) were cultured in a growth medium consisting of minimal essential medium (α-MEM) with 10% fetal bovine serum (FBS) and 1% penicillin/streptomycin. Cells were incubated in a humid incubator at 37°C (95% O2 and 5% CO2) and maintained in a subconfluent state unless otherwise indicated. Cells were subcultured every 72 h using 0.2% trypsin and 0.02% ethylenediamine tetra-acetic acid. For experiments, cells were cultured for 24 h to obtain monolayers containing α-MEM with 10% FBS.

Placing the onset of the Anthropocene at the Pleistocene–Holocene boundary in effect SCH772984 makes it coeval with the Holocene, and removes the formal requirement of establishing a new geological epoch. The Holocene and Anthropocene epochs could on practical terms be merged into the Holocene/Anthropocene epoch, easily

and efficiently encompassing 10,000 years of human modification of the earth’s biosphere. Recognizing the coeval nature of the Holocene and Anthropocene epochs could also open up a number of interesting possibilities. The International Commission on Stratigraphy of the International Union of Geological Sciences, for example, might consider a linked nomenclature change: “Holocene/Anthropocene”, with the term “Holocene” likely to continue to be employed in scientific contexts and “Anthropocene” gaining usage in popular discourse. Such a solution would seem to solve the current dilemma while also serving to focus additional attention and research interest on the past ten millennia of human engineering of the earth’s ecosystems. Situating the onset of the Anthropocene

at 11,000–9000 years ago and making it coeval with the Holocene broadens the scope of inquiry Ribociclib ic50 regarding human modification of the earth’s ecosystems to encompass the entirety of the long and complex history of how humans came to occupy central stage in shaping the future of our planet. It also shifts the focus away from gaseous emissions of smoke stacks and livestock, spikes in pollen diagrams, or new soil horizons of epochal proportions to a closer consideration of regional-scale ADAMTS5 documentation of the long and complex history of human interaction

with the environment that stretches back to the origin of our species up to the present day. We would like to thank Jon Erlandson and Todd Braje for their invitation to contribute to this special issue of Anthropocene, and for the thoughtful and substantial recommendations for improvement of our article that they and other reviewers provided. “
“For many geologists and climate scientists, earth’s fossil record reads like a soap opera in five parts. The episodes played out over the last 450 million years and the storylines are divided by five mass extinction events, biotic crises when at least half the planet’s macroscopic plants and animals disappeared. Geologists have used these mass extinctions to mark transitions to new geologic epochs (Table 1), and they are often called the “Big Five” extinctions. When these extinctions were first identified, they seemed to be outliers within an overall trend of decreasing extinctions and origination rates over the last 542 million years, the Phanerozoic Eon (Gilinsky, 1994, Raup, 1986 and Raup and Sepkoski, 1982).