An explanation for the skeletal phenotype of both these groups could be RNA Synthesis inhibitor that the osteoregulatory effects of mechanical strain influence Wnt signalling through the Lrp5 receptor. This explanation envisages the low bone mass in OPPG patients being due to inadequate strain-related stimulation of the Wnt pathway

resulting from failure of Wnt stimulation at the Lrp5 receptor [8], [9] and [10]. The high bone mass (HBM) in people with the Lrp5 mutation could be explained as being due to an exaggerated response to strain-related stimulation at the same receptor [8] and [10]. A potential mechanism for this hypothetical link between the osteogenic effects of strain and the Wnt pathway became evident with reports that sclerostin was a ligand for the Lrp5 receptor [11] and [12]. Sclerostin, the protein product of the SOST gene predominately expressed in Galunisertib in vitro osteocytes, is down-regulated by high local mechanical strain in vivo and SOST expression is up-regulated in the absence of loading [3] and [13]. Thus in normal individuals high strains would act to

depress sclerostin production allowing increased activity of the Wnt/Lrp5 pathway and enhanced bone formation. Low strains would be associated with high levels of sclerostin which would down-regulate activity of the Wnt/Lrp5 pathway with subsequent reduced bone formation. This could be one of the ways in which functional strains influence bone mass. Experiments on mice have shown that animals with the Lrp5 G171V HBM mutation recapitulate the HBM phenotype found in humans [14]. Those with the Lrp5 loss of function mutation also have a low bone mass phenotype similar to humans with OPPG [15]. Sawakami et al. (2006) report that the osteogenic response to mechanical load is significantly lower in male and female mice with the Lrp5 loss of function

mutation (Lrp5−/−) compared with Wild Type (WT+/+) controls [16], while Akhter et al. (2004) report that load-induced cortical bone formation is higher in female mice heterozygous for the Lrp5 Gl71V HBM mutation (Lrp5HBM+) SPTBN5 than in their WT (WTHBM−) controls [17]. Both of these reports are consistent with the hypothesis that Lrp5/Wnt signalling is involved in the osteoregulatory response of cortical bone to mechanical loading. Both Sawakami et al. and Akhter et al. performed their experiments using the axially loadable ulna technique originally developed in the rat by Torrance et al. [18] but now routinely applied to the mouse [3], [16], [19], [20] and [21]. One disadvantage of using the ulna is that it does not allow examination of loading-related effects on (re)modelling in trabecular bone. Another disadvantage is that it is not easy experimentally to induce disuse in the front limb and to assess the effects of removal of normal functional loading.

44 per 1000 (95% CI 1.17–1.75) in children under 6 years in Leicester in 2001–2002,30 and 1.57 per 1000 in children under 5 years in East London in 2002–2004.31 Like us, the authors of the meta-analysis found that the highest rate of severe influenza in children in developed countries was in infants under 6 months of age, 340 per 100,00 (95%

CI 230–500) (personal communication Dr. H. Nair) which is very similar to our estimate of 330 (95% CI 318–342). Our analyses indicate that additional strategies are needed to reduce the remaining morbidity and mortality in the high-risk and elderly populations, and to protect healthy children who are currently not offered the benefits of vaccination. Children play a key role in transmission of influenza and their vaccination is likely to bring additional herd immunity benefits.4

Vaccine coverage among pregnant women needs to improve click here both for their own protection and that of their infants during the first 6 months of life when influenza morbidity is highest. Annual age-stratified serological studies are needed to help understand the transmission dynamics of seasonal influenza and BIBF 1120 cost to document the impact on transmission of the annual vaccination of children aged 2–16 years which is now recommended in the United Kingdom to complement the age and risk-based policy in place since 2000.3 The same features in influenza burden may be present in other developed countries with a similar age and risk-based influenza vaccination Quisqualic acid programme; hence there may be value in considering similar policies in such settings. DC and

AJVH were funded by the Research and Development Directorate of the United Kingdom Department of Health, grant reference number 039/031. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript. DC, EM, WJE and MJ conceived and designed the study; DF extracted and analysed data on consultations in general practice and proportion of patient in clinical risk groups; AJVH analysed Hospital Episode Statistics data; DC carried out the statistical modelling; DC, EM, AJVH and MJ wrote the manuscript with input from DF and WJE. All authors meet ICMJE criteria for authorship, and agree with manuscript results and conclusions. WJE’s partner works for GlaxoSmithKline. DMF has served as an advisor to several pharmaceutical companies (including GlaxoSmithKline) on matters relating to the epidemiology of influenza and the effectiveness of influenza vaccination, and has received support to attend international meetings relating to influenza. We thank Julia Stowe and Pauline Kaye for extracting HES and LabBase2 data respectively, as well as Marc Baguelin for helpful discussions.

Hyper film and ECL plus reagents were purchased from Amersham Biosciences, UK. All other bio-chemicals and reagents used in studies were AR grade and purchased from Sigma Aldrich, India. 2, 3-Dihydro-2-(quinoline-5-yl)

quinazolin-4(1H)-one (DQQ) was synthesized as described earlier [16] (Fig. 1A). Anthranilamide (1, 1eq) and quinoline-4-carbaldehyde (2, 1eq) was dissolved in acetonitrile (5 ml) followed by amberlist-15 (50 mol %). The reaction mixture was stirred at room temperature, filters, concentrates and purified by column chromatography. DQQ is a light yellow solid with 85%yield; mp:253 -255 οC; 1H – NMR (400 MHz, DMSO-d6); δ (ppm), 9.30, (d, J = 8.4 Hz, 1H), 8.95 (s, 1H), 8.38 (s, 1H), 8.08, (m, 1H), 7.80 (m, 3H), 7.59 (m, 1H), 7.29 (t, J = 7.2 Hz, 1H) 7.12 (s, 1H), 6.77 (m, 2H), 6.49 (s, selleck 1H); 13CNMR (100 MHz, DMSO-d6); δ (ppm), 163.9, 150.2, 148.3, 148.2, 135.7, 133.3, 133.1, 130.3, 128.6, 127.4, 125.8, Selleck SB431542 120.9, 117.4, 115.0, 114.5, 79.1, 65.8; IR: (KBr-pellet) 3399. 3294, 2920, 2850, 1647, 1610, 1502, 1462, 1383, 1296, 1156, 1073, 795, 762, 708 cm−1; MS (Q-TOF): m/z 276 [M + 1]+, 298 [M + Na]+; HRMS: m/z 276.1130 calcd for C17H14N3O + H+ (276.1137). MTT assay was done to determine the viability of

the cells and was done as described previously [17]. Briefly, 6 × 103 cells were seeded in 96 well plates and were treated with different concentrations of DQQ for 48 h. 20 μl of MTT dye (2.5 mg/ml) was added 3 h before the termination of the experiment. The plates were centrifuged at 400 x g for 15 minutes and formulated MTT formazen crystals were dissolved in 150 μl of DMSO, absorbance was measured at 570 nm with reference wavelength 620 nm. Morphological changes second in cell were studied by phase contrast microscopy. MOLT-4 cells were incubated in twelve well plates and treated with different concentration of DQQ (2-10 μM) for 24 h, after that cells were subjected to photography on an inverted microscope attached to the DP-12 camera (1X70, Olympus). Cells were treated with different concentrations of

DQQ (2-10 μM) for 24 h and washed twice with PBS at 400 x g for 5 min. Cells were then stained with one milliliter of staining solution (10 μg/ml, Hoechst 33258, 0.01 M citric acid and 0.45 M disodium phosphate containing 0.05% Tween-20) and stained for 30 min in the dark at room temperature. After staining the cells were resuspended in 50 μl of mounting fluid (PBS: glycerol, 1:1) and 10 μl mounting suspension was observed for nuclear morphology under inverted fluorescence microscope using UV excitation (Olympus 1X70, magnification 30X) [18]. MOLT-4 cells (1 × 106) were treated with 2 μM, 5 μM and 10 μM concentrations of DQQ for 24 h. Cells were double stained with annexin-V/PI by using kit manufacture’s protocol (# sc4252, Santa Cruz Biotechnology, USA). The cells were scanned for fluorescence intensity in FL-1 (FITC) and FL-2 (PI) channels.

2C and 2D). Significant differences were not observed in subgroups [V(+24h) and BP(+24h)] in two different sets of experiments conducted at different times. As observed in experiment 1, mice on the control diet for 7, 14 and 28 days [subgroups BP(+8d), BP(+15d), BP(+29d)] showed a time-related significant decrease in total adduct levels as seen by adduct intensity

in the liver and lungs of mice compared to BP(+24h) and subgroup of preceding time point. Interestingly, mice that were shifted to 0.05% curcumin diet and killed at 7, 14 and 28 days [subgroups BP(+8d) + C7d, BP(+15d) + C14d, BP(+29d) + C28d] showed a significantly higher decrease find more in total levels of adduct intensity in the liver and lungs compared to BP(+24h) and respective time-matched controls [subgroups BP(+8d), BP(+15d),

BP(+29d)] (Figure 2 and Figure 3). This decrease was also evident when comparison of the percentage intensity of nuclei containing high, selleck chemical medium and low levels of adducts was made between curcumin-treated and time-matched controls. In the liver, the observed decrease in total adduct intensity appears to be attributed to reduction in percentage intensity of nuclei containing high and low levels of adducts. However, in lungs, it was mainly due to a decrease in intensity of nuclei containing high levels of adducts in mice shifted to 0.05% curcumin diet and killed at 7, 14 and 28 days [subgroups BP(+8d) + C7d, BP(+15d) + C14d, BP(+29d) + C28d] compared to BP(+24h) and respective time-matched controls [subgroups BP(+8d), BP(+15d), BP(+29d)] (Figs. 2C and 2D). These results suggest that dietary curcumin further enhanced the decrease in total adduct intensity in the liver and lungs of mice although the extent of decrease varied. The observed decrease in levels of BPDE-DNA adducts in liver and lungs may be attributed to increased loss

of adducts containing cells and/or enhanced DNA repair and/or dilution of adducted DNA by newly synthesized non-adducted DNA. To investigate the effect of dietary curcumin post-treatment on B(a)P-induced cell turnover in mouse liver and lungs, TUNEL assay was employed. Turnover see more of cells by apoptosis in the liver and lungs was measured in a similar area of tissue sections (mm2) and number of cells (∼800 cells/section/animal). Apoptotic index was measured in terms of total apoptotic nuclei intensity as well as the percentage of apoptotic positive and negative cells. Notably, 5-10% and 20-35% of total apoptotic nuclei were detected in the liver and lung tissues of vehicle [V(+24h), V(+48h), V(+96h), V(+144h)] or vehicle + curcumin [V(+48h) + C 24 h, V(+96h) + C 72 h, V(+144h) + C 120 h]-treated subgroups, respectively (Figs.

lillemodel.com/score.asp?score=lillept) 4, 6 and 60. Uma meta-análise englobando os dados dos 5 estudos mais recentes com a utilização de corticoides dividiu os doentes em percentis do score de Lille, classificando-os em respondedores completos (0-0,16), respondedores parciais (0,17-0,56) e não respondedores (> 0,56). Demonstrou-se uma melhoria estatisticamente significativa da corticoterapia

na sobrevida dos 2 primeiros subgrupos, pelo que poderá haver benefício em manter a terapêutica com corticoides mesmo com scores de Lille algo superiores ao cut-off determinado na validação inicial 61. Já antes tinha sido notado que uma diminuição precoce nos níveis de bilirrubina (definida www.selleckchem.com/products/H-89-dihydrochloride.html simplesmente como um valor de bilirrubina ao sétimo dia inferior ao da admissão), em doentes tratados com prednisolona, era um fator de prognóstico independente62. As alterações do fluxo portal (fluxo invertido ou alternante) nos doentes tratados com corticoides parecem também prever a mortalidade no primeiro ano, embora nenhuma alteração da conduta esteja recomendada em face destes resultados63. A pentoxifilina é um inibidor da fosfodiesterase, apresentando vários efeitos, entre os quais a diminuição da transcrição do TNF-α.

A sua administração na dosagem de 400 mg tid mostrou também diminuir a mortalidade às 4 semanas, de 46 para 24%, especialmente por diminuição da incidência da síndrome hepatorrenal14. Infelizmente, a pentoxifilina não mostrou qualquer eficácia em doentes não respondedores aos corticoides64. Alectinib Recentemente, foi descrito que a teofilina, um inibidor da fosfoinositídeo-3-cinase reconhecido pelo seu discreto

efeito broncodilatador, mas também por aumentar a sensibilidade pulmonar aos corticoides no tratamento da bronquite crónica, poderá ter um efeito semelhante a nível hepático na HAA, pelo menos in vitro. Serão necessários estudos clínicos para avaliar se a teofilina terá potencial Etomidate para diminuir a percentagem dos doentes não respondedores aos corticoides 65 and 66. A utilização de outras terapêuticas com efeitos anticitocinas na HAA foi proposta com base nos mecanismos fisiopatológicos envolvidos. Embora exista um forte racional para o uso de terapêutica anti-TNF-α na HAA, há também uma base teórica para minimizar a inibição do TNF-α, pois este desempenha um papel na regeneração dos hepatócitos, bem como na apoptose67. Num primeiro estudo, envolvendo pequeno número de doentes tratados com corticoide, o infliximab (anticorpo monoclonal quimérico anti-TNF-α) foi comparado com placebo, verificando-se uma diminuição significativa da FDM e dos níveis de citocinas (IL-1β, IL-6, IL-8, IFN-γ) ao 28.° d no grupo do infliximab, mas sem diferenças de mortalidade68.

Irreversible damage to membrane integrity caused by chilling during the lipid phase transition is directly related to the quantity of lipids present [3]. Cholesterol is a major structural lipid constituent of the membrane and regulates its function. Therefore, the cholesterol/phospholipid ratio is a vital determinant of plasma membrane fluidity and stability during cryopreservation [10]. Membranes with high concentrations

of cholesterol are more fluid at low temperatures and consequently more resistant to damage during cooling [40] and [41]. To increase membrane fluidity and permeability at low temperatures, cholesterol can be added to the plasma membrane, thereby providing an alternative method for increasing oocyte tolerance for cryopreservation. Selleckchem Proteasome inhibitor Cyclodextrins can act as carrier molecules for the incorporation of cholesterol into plasma membranes [1], [10] and [25]. Cyclodextrins are water-soluble cyclic oligosaccharides consisting of glucose units (α-d-glucopyranoside) joined by connections typeα-1,4 that contain a hydrophobic center capable of integrating lipids. Due to its structure, free cyclodextrin can selectively deplete cholesterol from isolated or intact membranes from a variety of cells, including spermatozoa and oocytes [23], whereas

cyclodextrins preloaded with cholesterol deliver cholesterol to the plasma membrane. Therefore, this simple approach can be used prior to cryopreservation to change the membrane composition and minimize membrane damage. Methyl-β-cyclodextrin (MβCD) is the most potent BIBW2992 solubility dmso cyclodextrin family member with respect to its affinity for cholesterol binding. Moreover, it was showed that cholesterol improve bovine [1] and [25] and equine [20] sperm viability Farnesyltransferase after cryopreservation [23]. One study demonstrated that cholesterol carried by cyclodextrin entered cumulus cells and oocytes, which improved the survival of vitrified mature bovine oocytes [10]. No further studies have investigated this simple approach to reduce oocyte

cold sensitivity. In the present study, we used MβCD to load cholesterol from fetal calf serum (FCS) and deliver it to the oocyte plasma membrane. The purpose of this study was to investigate the effect of MβCD exposure on the in vitro maturation rates and developmental ability of cold-stressed as well as vitrified immature bovine oocytes. Unless otherwise indicated, chemicals were purchased from Sigma (St. Louis, MO, USA). Cryotop devices were purchased from Ingámed (Maringá, PR, Brazil). Ovaries from crossbred cows (Bos indicus × Bos taurus) were collected immediately after slaughter and transported to the laboratory in saline solution (0.9% NaCl) supplemented with penicillin G (100 IU/mL) and streptomycin sulfate (100 g/mL) at 35 °C. Cumulus oocyte complexes (COCs) were aspirated from 3- to 8-mm diameter follicles with an 18-gauge needle and pooled in a 15-mL conical tube.

, 2010). More recently, Operation Cleansweep (www.opcleansweep.org), a joint initiative of the American Chemistry Council and Society of the Plastics Industry, is aiming for industries to commit to zero pellet loss during their operations. Within the marine environment, plastic is widely considered the primary constituent of ‘marine debris’, a category that includes both anthropogenic litter (e.g. glass, metal, wood), and naturally occurring flotsam (e.g. vegetation, pumice; Barnes et al., 2009, Moore, 2008, Ryan et al., 2009 and Thompson et al., 2004). However, Afatinib small plastic debris (<0.5 mm

in diameter) is considered a widely under-researched component of marine debris (Doyle et al., 2011) due to the difficulties in assessing the abundance, density and distribution of this contaminant within the marine environment. Quantifying the input of plastics DAPT cost into the marine environment is precluded by the array of pathways by which plastics may enter the oceans and would require accurate timescales of the length at which plastics

remain at sea prior to degradation (Ryan et al., 2009). Meanwhile, quantifying debris that has already reached the marine environment is complicated by the vastness of the oceans compared to the size of the plastics being assessed. Spatial and temporal variability owing to oceanic currents and seasonal patterns further complicate this issue (Doyle

et al., 2011 and Ryan et al., 2009). Nevertheless, a suite of sampling techniques has been developed that allow the presence of small plastic debris to be determined. These include: (1) beach combing; (2) sediment sampling; Resveratrol (3) marine trawls; (4) marine observational surveys; and (5) biological sampling. Beach combing is considered the easiest of the available techniques to conduct, requiring little logistical planning and relatively low costs (MCS, 2010). Typically carried out by researchers and environmental awareness groups, this technique involves collecting and identifying all litter items, in a systematic approach, along a specified stretch of coastline. By repeating the beach combing process on a regular basis, accumulation of plastic debris can be monitored over time (Ryan et al., 2009). This technique is particularly useful for determining the presence of macroplastics and plastic resin pellets, termed ‘Mermaid’s Tears’ by beach combers, but microplastics, especially those too small to be observed by the naked eye, are likely to go unnoticed using such a technique.

To reamplify Skp, forward primers were used to incorporate BglII, followed by the enhancer GAATTCATTAAAGAGGAGAAATTAACT and the periplasmic or cytoplasmic

versions of Skp. A reverse primer was designed that anneals to the entire V5 sequence and to an optimized Shine–Dalgarno (SD) sequence driving the translation initiation of FkpA. To reamplify FkpA, forward primers were designed to anneal to the C-terminal portion of V5, the optimized Selumetinib cost SD, and the periplasmic or cytoplasmic versions of FkpA. A reverse primer was designed to add a HindIII-FLAG tag sequence to the C-terminal portion of FkpA. The Skp and FkpA PCR products were then gel-purified using Qiagen gel extraction kits (Valencia, CA) and used as templates for an overlap extension

PCR reaction using the external forward Skp primer and an external reverse FkpA primer. Fig. 1a illustrates the resulting chaperone inserts. Ligations of the BglII–HindIII Cyclopamine nmr digested PCR products to the BglII–HindIII digested pAR3 vector were then transformed by electroporation into XL1-Blue cells. The final constructs were confirmed by DNA sequencing. All Fabs and scFv fragments used in this work were cloned into proprietary phagemid vectors (Schwimmer et al., 2013) harboring a triple 6His-cmyc-V5 tag, the beta lactamase gene conferring ampicillin resistance and the ColE1 origin of replication that is compatible with the p15A origin of the pAR3 vector (backbone for chaperone expressing vectors). The Fabs with kappa light chains used were: a) XPA23 (anti-IL1β, human), b) ING1 (anti-EpCAM, Fludarabine human), c) 83-7 (anti-human insulin receptor (huINSR), murine), d) CF1 (anti-Tie-1, human), and e) BM7-2 (anti-kinase, human). We also tested the lambda light chain containing gastrin-specific Fabs C10, D1, and E6. The antigens huINSR, Tie-1-Fc,

and IL1β were purchased from R&D Systems (Minneapolis, MN). In the phagemid vector expressing the ING1 Fab in the E. coli periplasm under the influence of the lac promoter, the gene fragment encoding the M13 phage pIII protein was replaced with cytFkpA. In order to produce the tricistronic construct ( Fig. 1b), two non-amber stop codons were added following the triple detection tag 6His-cmyc-V5. The gene fragment cytFkpA was amplified by PCR from the vector pAR3-cytFkpA, together with an upstream enhancer sequence and C-terminal FLAG tag. The final construct was cloned into the modified phagemid expressing the ING1 Fab. TG1 electroporation-competent cells were co-transformed with the Fab expressing vectors that were previously described along with one of the chaperone-expressing vectors pAR3-FkpA, pAR3-Skp, pAR3-cytFkpA, pAR3-cytSkp, or the bicistronic pAR3-[Skp + FkpA], and pAR3-cyt[Skp + FkpA]. Co-expression of the Fab-expressing vectors with the empty plasmid pAR3 served as a negative control.

1A and B),

as much in the sarcoplasm as in the endomysium. The animals of TD group (Fig. 1D) presented a reaction in the sarcoplasm very similar to the one observed on the control groups; on the other hand, the recovery was not that evident on the endomysium. The technique of picrosirius-hematoxylin (Fig. 2) showed a find more little increase on the concentration of collagen fibers on the endomysium of the animals from SD group (Fig. 2C) when compared to the control groups (Fig. 2A and B), showing a possible deposition of this kind of fiber. The TD group (Fig. 2D) presented a reaction a lot similar to the ones seen on the SC and TC groups. The ammoniacal silver technique did not show too much of a difference among the individuals of the four groups, except that the animals of group SD (Fig. Dasatinib 3C) had a little higher reaction in comparison with the animals

of the groups SC, TC and TD (Fig. 3A, B and D, respectively). Diabetic animals showed a characteristic hyperglycemia, which is considered the main factor, at cellular level, responsible for the morphological damage caused by diabetes. The hyperglycemia seems to be the central mechanism triggering the processes that lead to the ultimate pathologic changes of myocardial hypertrophy, fibrosis, and collagen deposition (Aneja et al., 2008). This condition causes an oxidative stress and activates messenger pathways that lead to cardiac fibrosis

and cell death. The link between hyperglycemia and the development of diabetic cardiomyopathy seems to involve the accumulation of advanced glycated end products (Aragno et al., 2008). Practicing physical exercises regularly is well known as an effective way to prevent numerous chronic diseases, such as diabetes. This regular practice improves the metabolic Rolziracetam control on diabetic individuals, an important component on the treatment of diabetes mellitus (American Diabetes Association, 1994). Several studies have shown the benefit effects of exercise on the control of glucose levels, both on animal experimentation and as on humans (Hardin et al., 1995, Aronson et al., 1997, Gobatto et al., 2001, Gomes et al., 2005 and Gomes et al., 2009). In the present work, although not statistically significant, exercise promotes a slight decrease in blood glucose levels. This reduction may have been sufficient to prevent some morphological changes caused by hyperglycemia. The muscle contractile stimulus lead to the translocation of the GLUT4 to the plasmatic membrane by the AMPK’s signalers pathway (Machado et al., 2006), improving the glucose caption.

, 2012). While specific details may differ in tropical countries, the examples from China and Europe indicate that targeted regulatory policy approaches can

greatly enhance the protection of downstream coral reef ecosystems from land-based pollution. Third, management efforts to control agricultural pollution need to be at relevant spatio-temporal scales to achieve desired ecological outcomes on downstream coral reefs. The magnitude of effort required to obtain significant pollution reductions is exemplified in non-tropical systems, including (i) (unintended) large cuts in pollutant sources (e.g. ∼95% cut in fertilizer use and ∼70% drop in livestock numbers in Latvian rivers (Stålnacke et al., 2003)), (ii) application at large spatial scales (e.g. 84,000 km2 of land terracing, tree and grass planting, and construction of sediment trapping dams in China PI3K inhibitor (Chu et al., 2009)), and (iii) adaptive implementation over decadal time frames (e.g. >25 years in Denmark (Windolf et al., 2012)) (Table 2). Across all European rivers, substantial decreases in the nutrient input from agriculture contributed to nutrient load reductions at end-of-river. The Chinese and Danish cases further demonstrate that targeted and simultaneous implementation of a combination of measures will augment

reductions of pollutant fluxes at watershed outlets. Enhanced targeting and upscaling of management efforts in agricultural systems will improve the condition of coral reef ecosystems, whilst also preventing further detrimental impacts from predicted increases in Caspase inhibition sediment and nutrient fluxes in the next 50 years. Finally, sustained monitoring at appropriate spatio-temporal scales is required to ascertain whether agricultural management results in

desired improvements of downstream coral reef ecosystems. Importantly, Tolmetin these monitoring programs should be driven by the development of critical questions and objectives, a conceptual understanding of linkages between desired outcomes and land-based pollution (Bartley et al., 2014), robust statistical design, and adaptive review cycles (Lindenmayer and Likens, 2009). In complex systems such as coral reefs, this would maximize the probability of detecting trends following management intervention, which could take years to decades even in comprehensively monitored systems (Darnell et al., 2012 and Meals et al., 2010). Importantly, consideration of desired outcomes for coral reefs in monitoring programs will focus efforts towards detecting change in relevant metrics. For example, specific biological indicators have been identified that link changes in marine water quality to changes in the condition of coral reef ecosystems (Cooper et al., 2009). Similar metrics in upstream watersheds will enable the assessment of progress early in the management phase and alert managers to potential unintended consequences, e.g.