The upregulation of syndecan-4 is induced by Pax5, as multipotent CLP-like pro-/pre-B cells commit themselves to B-cell differentiation [18, 30]. Syndecan-4 is also expressed on stromal cells located in fetal liver and BM in the proximity of these proB and preBCR+pre-B cells [31]. More specifically, syndecan-4 could interact with the non-Ig portion of the lambda5-component of it [32]. Furthermore, pre-B cells and stromal cells could Selleckchem BI2536 also establish contacts by mutual interactions of their heparin-sulfate side-chains of syndecan-4 with other heparin-sulfate-containing proteoglycans on the opposite types of cells.

We hypothesize that a miR-221-induced reduction in the surface expression of syndecan-4, as seen by us, could contribute to a change in quantity, thus also quality of its interactions with F-actin-filaments and, consequently, favor the residence of miR-221-expressing cells in the multipotent CLP/like pro//pre-B-cell niches. It remains a formidable challenge to understand how the 25 genes that we reduced in their expression by miR-221 can lead to a changed migration

to, and residence in BM. If this activity of miR-221 C646 manufacturer has comparable functional consequences for pHSCs and MPPs, also of humans, overexpression of this miRNA might improve the migration and residence also of these cells and, thereby, improve efficiencies of BM transplantations, also in clinical settings. C57BL/6 (CD45.1) and Rag1−/− (CD45.2) mice were bred in the laboratory animal facility of the Max-Planck-Institute under SPF conditions. miRNAs were induced in vivo feeding mice continuously, in half-weekly changes, with drinking water containing 0.2 g/L doxycycline and 50 g/L sucrose at pH 3.0. All of the experimental procedures Suplatast tosilate complied with “National Regulations for the Care and Use

of Laboratory Animals” (protocol G0099/08 approved by the Landesamt für Gesundheit und Soziales, Berlin). Pre-B-I cells derived from WT fetal liver (C57BL/6, CD45.1+) at day 18 of gestation and Pax5−/− pro-/pre-B cells were grown as described before [15]. The stromal cell line OP9 and OP9Δl-1 were kindly given to us by Dr. Zuniga-Pfluecker (University of Toronto, Canada). Cytokine supernatants were produced using the hybridoma cell lines J558L/IL-7 and Sp2.0-Flt3L (a kind gift of Dr. Paulo Vieira, Institute Pasteur, Paris, France). In vitro differentiation experiments were done as described [33]. Cells were harvested and analyzed by flow cytometry 3 days after incubation. MiR-221 and miR-222 were cloned into the vector pSM30-EGFP [22] by cutting the vector with BsmB-I and annealing the oligos, which contained the mature miRNAs (see Supporting Information Fig. 2A). The top oligo sequences were: miR-221: AGCGCGCTACATTGTCTGCTGGGTTTCTAGTGAAGCCACAGATGTAGAAACCCAGCAGACAATGTAGCT; miR-222: AGCGCGCTACATCTGGCTACTGGGTTAGTGAAGCCACAGATGTAACCCAGTAGCCAGATGTAGCT.