To reamplify Skp, forward primers were used to incorporate BglII, followed by the enhancer GAATTCATTAAAGAGGAGAAATTAACT and the periplasmic or cytoplasmic

versions of Skp. A reverse primer was designed that anneals to the entire V5 sequence and to an optimized Shine–Dalgarno (SD) sequence driving the translation initiation of FkpA. To reamplify FkpA, forward primers were designed to anneal to the C-terminal portion of V5, the optimized Selumetinib cost SD, and the periplasmic or cytoplasmic versions of FkpA. A reverse primer was designed to add a HindIII-FLAG tag sequence to the C-terminal portion of FkpA. The Skp and FkpA PCR products were then gel-purified using Qiagen gel extraction kits (Valencia, CA) and used as templates for an overlap extension

PCR reaction using the external forward Skp primer and an external reverse FkpA primer. Fig. 1a illustrates the resulting chaperone inserts. Ligations of the BglII–HindIII Cyclopamine nmr digested PCR products to the BglII–HindIII digested pAR3 vector were then transformed by electroporation into XL1-Blue cells. The final constructs were confirmed by DNA sequencing. All Fabs and scFv fragments used in this work were cloned into proprietary phagemid vectors (Schwimmer et al., 2013) harboring a triple 6His-cmyc-V5 tag, the beta lactamase gene conferring ampicillin resistance and the ColE1 origin of replication that is compatible with the p15A origin of the pAR3 vector (backbone for chaperone expressing vectors). The Fabs with kappa light chains used were: a) XPA23 (anti-IL1β, human), b) ING1 (anti-EpCAM, Fludarabine human), c) 83-7 (anti-human insulin receptor (huINSR), murine), d) CF1 (anti-Tie-1, human), and e) BM7-2 (anti-kinase, human). We also tested the lambda light chain containing gastrin-specific Fabs C10, D1, and E6. The antigens huINSR, Tie-1-Fc,

and IL1β were purchased from R&D Systems (Minneapolis, MN). In the phagemid vector expressing the ING1 Fab in the E. coli periplasm under the influence of the lac promoter, the gene fragment encoding the M13 phage pIII protein was replaced with cytFkpA. In order to produce the tricistronic construct ( Fig. 1b), two non-amber stop codons were added following the triple detection tag 6His-cmyc-V5. The gene fragment cytFkpA was amplified by PCR from the vector pAR3-cytFkpA, together with an upstream enhancer sequence and C-terminal FLAG tag. The final construct was cloned into the modified phagemid expressing the ING1 Fab. TG1 electroporation-competent cells were co-transformed with the Fab expressing vectors that were previously described along with one of the chaperone-expressing vectors pAR3-FkpA, pAR3-Skp, pAR3-cytFkpA, pAR3-cytSkp, or the bicistronic pAR3-[Skp + FkpA], and pAR3-cyt[Skp + FkpA]. Co-expression of the Fab-expressing vectors with the empty plasmid pAR3 served as a negative control.